View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_high_11 (Length: 319)
Name: NF0748_high_11
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 6e-34; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 87 - 164
Target Start/End: Original strand, 18365696 - 18365773
Alignment:
| Q |
87 |
ttatgtgatatgttatcttcagatgggaaactacgtaaggaaaaatgaattgaaaaagcgcagagaaaatgatttgat |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18365696 |
ttatgtgatatgttatcttcagatgggaaactacgtaaggaaaaatgaattgaaaaagcgcagagaaaaggatttgat |
18365773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 87 - 187
Target Start/End: Original strand, 30936570 - 30936665
Alignment:
| Q |
87 |
ttatgtgatatgttatcttcagatgggaaactacgtaaggaaaaatgaattgaaaaagcgcagagaaaatgatttgatttgatagaagacttgctactat |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
30936570 |
ttatctgatatgttatcttcagatgggaaactacgtaaggaaaaatgaattgaaaaagcgcagagaaaa-----ggaattgatagaagacttgctactat |
30936664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 244 - 293
Target Start/End: Original strand, 18365846 - 18365895
Alignment:
| Q |
244 |
atcttgccctggacatttcataatggagctatatttttcttctgtctgtg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
18365846 |
atcttgccctggacatttcataatggagctatatttttcttgtgtgtgtg |
18365895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 244 - 293
Target Start/End: Original strand, 30936741 - 30936790
Alignment:
| Q |
244 |
atcttgccctggacatttcataatggagctatatttttcttctgtctgtg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
30936741 |
atcttgccctggacatttcataatggagctatatttttcttgtgtgtgtg |
30936790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 87 - 187
Target Start/End: Complemental strand, 22589085 - 22588990
Alignment:
| Q |
87 |
ttatgtgatatgttatcttcagatgggaaactacgtaaggaaaaatgaattgaaaaagcgcagagaaaatgatttgatttgatagaagacttgctactat |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22589085 |
ttatctgatatgttatcttcagatgggaaactacgtaaggaaaaatgaattgaaaaagcgcagagaaaa-----ggatttgatagaagacttgctactat |
22588991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 244 - 293
Target Start/End: Complemental strand, 22588922 - 22588873
Alignment:
| Q |
244 |
atcttgccctggacatttcataatggagctatatttttcttctgtctgtg |
293 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
22588922 |
atcttgccctagacatttcataatggagatatatttttcttgtgtgtgtg |
22588873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University