View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0748_high_13 (Length: 297)

Name: NF0748_high_13
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0748_high_13
NF0748_high_13
[»] chr3 (1 HSPs)
chr3 (5-199)||(46388178-46388372)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 199
Target Start/End: Original strand, 46388178 - 46388372
Alignment:
5 cttaatgttttgtacaattaactatctgaggtccaagttgaccataaatattattattgaaaaggtcaacagagactgcacgatgggtggcatacgacac 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
46388178 cttaatgttttgtacaattaactatctgaggtccaagttgaccataaatattattattgaaaaggtcaacagagactacacgatgggtggcatacgacac 46388277  T
105 acttccatgaacatggtgtggagtgagaatgaatttatgtagagtttatgggaggaggagccgatgtccaatgcctggtgaatgacatgagtgct 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
46388278 acttccatgaacatggtgtggagtgagaatgaatttatgtagagtttatgggaggaggagccgatgtccagtgcctggtgaatgacatgagtgct 46388372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University