View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_high_14 (Length: 273)
Name: NF0748_high_14
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 51 - 238
Target Start/End: Complemental strand, 45220990 - 45220805
Alignment:
| Q |
51 |
acctcagacgccatacttctccgcattatacgatcttgcatactgcaaagtcctgtcagttgagagttacgttttttatttgctgaggaaatgagttgtt |
150 |
Q |
| |
|
|||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45220990 |
accttagacaccatacttctccacattatacgatcttgcatactgcaaagtcctgtcagttgag--ttacgttttttatttgctgaggaaatgagttgtt |
45220893 |
T |
|
| Q |
151 |
tattagtaaaataaaattctgtgcgtacgcaataacatagaatatcaacatcaatgtaccataccctccattaacatagccctttttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45220892 |
tattagtaaaataaaattctgtgcgtacgcaataacatagaatatcaacatcaatgtaccataccctccattaacatagccctttttc |
45220805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5166 times since January 2019
Visitors: 4845