View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_high_19 (Length: 217)
Name: NF0748_high_19
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0748_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 33 - 125
Target Start/End: Complemental strand, 32640222 - 32640130
Alignment:
Q |
33 |
tttataagcttgattaatttataaactaattatcactaattagaaaaatattactgttaatattagaaagttaaatgttaaagactaatttga |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
32640222 |
tttataagcttgattaatttataaactaattatcactaattagaaaaatattactgttaatattagaaaggtaaatgttaaagactaatttga |
32640130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 32640277 - 32640243
Alignment:
Q |
1 |
gacaagcttttcaaagatggtacaatacctaattt |
35 |
Q |
|
|
||||||||||||||||||||||||||| ||||||| |
|
|
T |
32640277 |
gacaagcttttcaaagatggtacaataactaattt |
32640243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4752 times since January 2019
Visitors: 4839