View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_21 (Length: 319)
Name: NF0748_low_21
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 68 - 177
Target Start/End: Original strand, 20381320 - 20381425
Alignment:
| Q |
68 |
gaacctgtggatgagatgaagtattttacaaagtcaaattattttgtatgttgcgaatggcaggcaagggggttagatacgacagaatcatattcttaga |
167 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20381320 |
gaacttgtggatgagatgaaatatttcacaaagtcaaattattttgtatgttgcgaat----ggcaagggagttagatacgacagaatcatattcttaga |
20381415 |
T |
 |
| Q |
168 |
gaataagatt |
177 |
Q |
| |
|
|||||||||| |
|
|
| T |
20381416 |
gaataagatt |
20381425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University