View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_29 (Length: 303)
Name: NF0748_low_29
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 95 - 240
Target Start/End: Original strand, 19077391 - 19077536
Alignment:
| Q |
95 |
gatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcagaatttcctaaaagacgttaacttatattaaagtga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
19077391 |
gatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcagaatttcgtagaagacgttaacttatattaaagtga |
19077490 |
T |
|
| Q |
195 |
agtgatataaaaggtgattaaggaatcgtcatatatggttgttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
19077491 |
agtgatataaaaggtgattaaggaatcgccatgtctggttgttcat |
19077536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 95 - 240
Target Start/End: Original strand, 19079116 - 19079261
Alignment:
| Q |
95 |
gatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcagaatttcctaaaagacgttaacttatattaaagtga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
19079116 |
gatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcaaaatttcgtagaagacgttaacttatattaaagtga |
19079215 |
T |
|
| Q |
195 |
agtgatataaaaggtgattaaggaatcgtcatatatggttgttcat |
240 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
19079216 |
agtgatgtaaaaggtgattaaggaatcgtcatatttgattgttcat |
19079261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 19077297 - 19077356
Alignment:
| Q |
1 |
aatgataagttatatcccatgagtttaggcgtagaagctgcaattgattaacctaaggtg |
60 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19077297 |
aatgatgagttatatccaatgagtttaggcgtagaagctgcaattgattaacctaaggtg |
19077356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3915 times since January 2019
Visitors: 4824