View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_30 (Length: 297)
Name: NF0748_low_30
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 199
Target Start/End: Original strand, 46388178 - 46388372
Alignment:
| Q |
5 |
cttaatgttttgtacaattaactatctgaggtccaagttgaccataaatattattattgaaaaggtcaacagagactgcacgatgggtggcatacgacac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46388178 |
cttaatgttttgtacaattaactatctgaggtccaagttgaccataaatattattattgaaaaggtcaacagagactacacgatgggtggcatacgacac |
46388277 |
T |
 |
| Q |
105 |
acttccatgaacatggtgtggagtgagaatgaatttatgtagagtttatgggaggaggagccgatgtccaatgcctggtgaatgacatgagtgct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46388278 |
acttccatgaacatggtgtggagtgagaatgaatttatgtagagtttatgggaggaggagccgatgtccagtgcctggtgaatgacatgagtgct |
46388372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University