View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0748_low_32 (Length: 273)

Name: NF0748_low_32
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0748_low_32
NF0748_low_32
[»] chr7 (1 HSPs)
chr7 (51-238)||(45220805-45220990)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 51 - 238
Target Start/End: Complemental strand, 45220990 - 45220805
Alignment:
51 acctcagacgccatacttctccgcattatacgatcttgcatactgcaaagtcctgtcagttgagagttacgttttttatttgctgaggaaatgagttgtt 150  Q
    |||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
45220990 accttagacaccatacttctccacattatacgatcttgcatactgcaaagtcctgtcagttgag--ttacgttttttatttgctgaggaaatgagttgtt 45220893  T
151 tattagtaaaataaaattctgtgcgtacgcaataacatagaatatcaacatcaatgtaccataccctccattaacatagccctttttc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45220892 tattagtaaaataaaattctgtgcgtacgcaataacatagaatatcaacatcaatgtaccataccctccattaacatagccctttttc 45220805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3470 times since January 2019
Visitors: 4814