View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_33 (Length: 272)
Name: NF0748_low_33
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 34985823 - 34985608
Alignment:
| Q |
1 |
aaattctgatagccaacatgaatattttttgacaatccaannnnnnn-attaacaatgacataaaagaccaatttgacaatacatacaaaggacaagaca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34985823 |
aaattctgatagccaacatgaatattttttgacaatccaattttttttattaacaatgacataaaagaccaatttgacaatacatacaaaggacaagaca |
34985724 |
T |
|
| Q |
100 |
a-----actagcaagaatttttaaggatgtttaattcttggttttctcaatttctttattaacacagttcttaaaatcacttgaggatatttaattcttt |
194 |
Q |
| |
|
| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34985723 |
agttaaactagcaagaattttttaggaggtttaattcttggttttctcaatttctttattaacacagttcttaaaatcacttgatcatatttaattcttt |
34985624 |
T |
|
| Q |
195 |
gttttctcaatttctt |
210 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34985623 |
gttttctcaatttctt |
34985608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 203 - 243
Target Start/End: Complemental strand, 34985599 - 34985559
Alignment:
| Q |
203 |
aatttcttaaaggaaaattaatagcatattatagtacttac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34985599 |
aatttcttaaaggaaaattaatagcatattatagaacttac |
34985559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 34985634 - 34985589
Alignment:
| Q |
124 |
tttaattcttggttttctcaatttctttattaacacagttcttaaa |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| | |||||||| |
|
|
| T |
34985634 |
tttaattctttgttttctcaatttctttattaacaaatttcttaaa |
34985589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 34993697 - 34993662
Alignment:
| Q |
166 |
taaaatcacttgaggatatttaattctttgttttct |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34993697 |
taaaatcacttgatgatatttaattctttgttttct |
34993662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3129 times since January 2019
Visitors: 4805