View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_44 (Length: 228)
Name: NF0748_low_44
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46388198 - 46387976
Alignment:
| Q |
1 |
ttaattgtacaaaacattaaggcatgtacttgaatggaaatcagttgcagagtctcgttccctacactctaaaccatttcaatcatcttctttgcattaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46388198 |
ttaattgtacaaaacattaagacatttacttgaatgaaaatcagttgcagagtctcgttccccacactctaaaccatttcaatcatcttcttcgcattaa |
46388099 |
T |
 |
| Q |
101 |
tgttcttccaataaattttagttgtnnnnnnnntttgttgcctacaataaactagcatgtatcatccaatttttctgctatggatgttgaaaaaatgtta |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46388098 |
tgttcttccaataaattttagttgtaaaaaaaatttgttgcctacaataaactaacatgtatcatccaatttttctgctatgaatgttgaaaaaatgtta |
46387999 |
T |
 |
| Q |
201 |
ctttttgttttgttcatctcact |
223 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
46387998 |
ctttttgttttgttcttctcact |
46387976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University