View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0748_low_46 (Length: 217)

Name: NF0748_low_46
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0748_low_46
NF0748_low_46
[»] chr2 (2 HSPs)
chr2 (33-125)||(32640130-32640222)
chr2 (1-35)||(32640243-32640277)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 33 - 125
Target Start/End: Complemental strand, 32640222 - 32640130
Alignment:
33 tttataagcttgattaatttataaactaattatcactaattagaaaaatattactgttaatattagaaagttaaatgttaaagactaatttga 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
32640222 tttataagcttgattaatttataaactaattatcactaattagaaaaatattactgttaatattagaaaggtaaatgttaaagactaatttga 32640130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 32640277 - 32640243
Alignment:
1 gacaagcttttcaaagatggtacaatacctaattt 35  Q
    ||||||||||||||||||||||||||| |||||||    
32640277 gacaagcttttcaaagatggtacaataactaattt 32640243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5310 times since January 2019
Visitors: 4847