View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_47 (Length: 217)
Name: NF0748_low_47
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0748_low_47 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 32177078 - 32176862
Alignment:
| Q |
1 |
aaaaaggtcaaaaggaagcgtcatcaccacggtcgatcaagtggcttgatgatcaacctattggttctgtggtgtatgtttgctttggaagcaggactac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177078 |
aaaaaggtcaaaaggaagcgtcatcaccacggtcgatcaagtggcttgatgatcaacctattggttctgtggtgtatgtttgctttggaagcaggactac |
32176979 |
T |
|
| Q |
101 |
acttggaagggaacaaatgaaagagattggtgatggattgatgaggagtggatacaaatttgtgtggggggtgaaggataagattgttgacaaagaagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32176978 |
acttggaagggaacaaatgaaagagattggtgatggattgatgaggagtggatacaaatttttgtgggtggtgaaggataagattgttgacaaagaagaa |
32176879 |
T |
|
| Q |
201 |
gaagtggggttagatga |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32176878 |
gaagtggggttagatga |
32176862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 38 - 217
Target Start/End: Complemental strand, 32184211 - 32184029
Alignment:
| Q |
38 |
caagtggcttgatgatcaacctattggttctgtggtgtatgtttgctttggaagcaggactacacttggaagggaacaaatgaaagagattggtgatgga |
137 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||| ||| || | |||||||| ||||||| ||||||||||||||| |
|
|
| T |
32184211 |
caagtggcttgatgaacaacctattggatctgtggtttatgtttgctttggaagcagaactgcattaggaagggaccaaatgagagagattggtgatggg |
32184112 |
T |
|
| Q |
138 |
ttgatgaggagtggatacaaatttgtgtggggggtgaaggataagattgttgacaaagaag---aagaagtggggttagatga |
217 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||| || ||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
32184111 |
ttgatgagaagtggatacaattttttgtgggttgttaaggataagattgttgacaaagaagataaagaagttgggttagatga |
32184029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 199
Target Start/End: Original strand, 21004024 - 21004175
Alignment:
| Q |
48 |
gatgatcaacctattggttctgtggtgtatgtttgctttggaagcaggactacacttggaagggaacaaatgaaagagattggtgatggattgatgagga |
147 |
Q |
| |
|
||||| ||||||||| | | |||||| |||||||| |||| |||||| || | |||||||| ||||||| ||||||| |||| ||||||| | |
|
|
| T |
21004024 |
gatgagcaacctattaggtttgtggtttatgtttggtttgaaagcagagctgtgttgggaagggaccaaatgagagagattcaaaatgggttgatgaaaa |
21004123 |
T |
|
| Q |
148 |
gtggatacaaatttgtgtggggggtgaaggataagattgttgacaaagaaga |
199 |
Q |
| |
|
||||| | |||||| |||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
21004124 |
gtggacataaatttttgtgggtggttaaggataagattgttgacaaggaaga |
21004175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5422 times since January 2019
Visitors: 4850