View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0748_low_9 (Length: 393)
Name: NF0748_low_9
Description: NF0748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0748_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 50454126 - 50454365
Alignment:
Q |
1 |
tcatcattgtgcatgtatacagaatacagctaaaggcaccaatctgagagcagatgcacaagcacacacttcaacgaatccctgtataactattttcctt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50454126 |
tcatcattgtgcatgtatacagaatacagctaaaggcaccaatctgagagcagatgcacaagcacacacttcaacgaatccctgtataactattttcctt |
50454225 |
T |
 |
Q |
101 |
ttccttatacaaatatatctgtcttctcaatttaacctgaaatagaataaaattatccaaaagctagcagaacagaatggtaatagaaaatttacccgtg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
50454226 |
ttccttatacaaatatatctgtcttctcaatttaacctgaaatagaataaaattatccaaaaactagcagaacagaatggtaatagaaaatttacccgtg |
50454325 |
T |
 |
Q |
201 |
tctttctctgattgagcagcatagtttttatccaacttcg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50454326 |
tctttctctgattgagcagcatagtttttatccaacttcg |
50454365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3731 times since January 2019
Visitors: 4818