View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_high_19 (Length: 261)
Name: NF0749_high_19
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 35410085 - 35409851
Alignment:
| Q |
1 |
ccactcagccatatggcattagactacttactgaagattatccttatgcggctgatggactccccatatggactagtatagagaagttggtcaggacctg |
100 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35410085 |
ccactcggccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggtctagtatagagaagttggtcaggaccta |
35409986 |
T |
 |
| Q |
101 |
tgtgaaccattactacaaagatttaaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctgatcataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409985 |
tgtgaaccattactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctgatcataaa |
35409886 |
T |
 |
| Q |
201 |
aatgctacctggtggcctaaactaaacacccctga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409885 |
aatgctacctggtggcctaaactaaacacccctga |
35409851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University