View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_high_21 (Length: 251)
Name: NF0749_high_21
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 648687 - 648926
Alignment:
| Q |
1 |
tatggtcttcacgtgctcattttgtcgtaatttgctcaagtgatcttcttatatgacgaaactgaagcccaaatcgcacaattgatatacgagtcaaaag |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| | || |||||| |
|
|
| T |
648687 |
tatggtcttcacatgctcattttgtcgtaatttgctaaagtgatcttcttat--gacgaaactgaagcccaaatcgcacaattgatatgctagccaaaag |
648784 |
T |
|
| Q |
101 |
tgcaattatgcctaatattaatcaaagtggcgttaattaccactctttacaaattgtcccggaggaaatttgaactcgacattacaaggttaagattttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
648785 |
tgcaattatgcctaatattaatcaaagtggcgttaattaccactctttacaaattgtcccagaggaaatttgaactcgacattacaaggttaagattttg |
648884 |
T |
|
| Q |
201 |
ccactgaactag-----caagtgttaatctcaatgcatggtt |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
648885 |
ccactgaactagcacctcaagtgttaatctcaatgcacggtt |
648926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5799 times since January 2019
Visitors: 4859