View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0749_high_26 (Length: 201)

Name: NF0749_high_26
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0749_high_26
NF0749_high_26
[»] chr3 (2 HSPs)
chr3 (1-122)||(35977464-35977585)
chr3 (36-98)||(35954775-35954837)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 35977585 - 35977464
Alignment:
1 tagacagttcctactaagcaggagtatagtgttgagtaagccatgtggtctggtttatcttgaagactattttggtgttttgtgtattcttgtcttcttt 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
35977585 tagacagttcctaccaagcaggagtatagtgttgagtaagccatgtggtctggttcatcttgaagactattttggtgttttgtgtattcttgtcttcttt 35977486  T
101 tcagaaaataataatatgatat 122  Q
    | ||||||||||||||||||||    
35977485 tgagaaaataataatatgatat 35977464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 36 - 98
Target Start/End: Complemental strand, 35954837 - 35954775
Alignment:
36 gtaagccatgtggtctggtttatcttgaagactattttggtgttttgtgtattcttgtcttct 98  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||| ||||    
35954837 gtaagccatgtggtctggtcaatcttgaagactattttggtgttttgtgtatttttgttttct 35954775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4112 times since January 2019
Visitors: 4827