View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_high_26 (Length: 201)
Name: NF0749_high_26
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0749_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 35977585 - 35977464
Alignment:
Q |
1 |
tagacagttcctactaagcaggagtatagtgttgagtaagccatgtggtctggtttatcttgaagactattttggtgttttgtgtattcttgtcttcttt |
100 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35977585 |
tagacagttcctaccaagcaggagtatagtgttgagtaagccatgtggtctggttcatcttgaagactattttggtgttttgtgtattcttgtcttcttt |
35977486 |
T |
 |
Q |
101 |
tcagaaaataataatatgatat |
122 |
Q |
|
|
| |||||||||||||||||||| |
|
|
T |
35977485 |
tgagaaaataataatatgatat |
35977464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 36 - 98
Target Start/End: Complemental strand, 35954837 - 35954775
Alignment:
Q |
36 |
gtaagccatgtggtctggtttatcttgaagactattttggtgttttgtgtattcttgtcttct |
98 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |
|
|
T |
35954837 |
gtaagccatgtggtctggtcaatcttgaagactattttggtgttttgtgtatttttgttttct |
35954775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University