View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_22 (Length: 353)
Name: NF0749_low_22
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 3112759 - 3112998
Alignment:
| Q |
1 |
tcatcatgtgaagttttcatcttttgaagtgtattcatttttagtgctcttaaccaacgctcctcaaaattggtgagaatgtcataggcagcaggaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112759 |
tcatcatgtgaagttttcatcttttgaagtgtattcatttttagtgctcttaaccaacgctcctcaaaattggtgagaatgtcataggcagcaggaccat |
3112858 |
T |
|
| Q |
101 |
caactttggaatgcaaatcatgccatggttgtcttggacaaccagtaacagaaccctgtttagtatgcaaattaaaactcagttcattcataacctctat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112859 |
caactttggaatgcaaatcatgccatggttgtcttggacaaccagtaacagaaccctgtttagtatgcaaattaaaactcagttcattcataacctctat |
3112958 |
T |
|
| Q |
201 |
tatgacaaattgattatgtattctcaaccattaaactctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112959 |
tatgacaaattgattatgtattctcaaccattaaactctg |
3112998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 3119199 - 3119355
Alignment:
| Q |
1 |
tcatcatgtgaagttttcatcttttgaagtgtattcatttttagtgctcttaaccaacgctcctcaaaattggtgagaatgtcataggcagcaggaccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||| | |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3119199 |
tcatcatgtgaagttttcatcttttgaagtgtagtcatttttaatgccatcaaccaacgctcctcaaaattggtgaggatgtcataggcagcaggaccat |
3119298 |
T |
|
| Q |
101 |
caactttggaatgcaaatcatgccatggttgtcttggacaaccagtaacagaaccct |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3119299 |
caactttggaatgcaaatcatgccatggttgtcttggacaaccggtaacagaaccct |
3119355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4753 times since January 2019
Visitors: 4839