View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_23 (Length: 351)
Name: NF0749_low_23
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 100 - 257
Target Start/End: Original strand, 46714619 - 46714782
Alignment:
| Q |
100 |
tcttcttatataaatgacaacaaagaataaaaagagact----tatcaaatatcaaaatac-nnnnnnnnnaagaaatatcaaaagacttgctatgtgaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46714619 |
tcttcttatataaatgacaacaaagaataaaaagagacttatatatcaaatatcaaaatacttttttttaaaagaaatatcaaaagacttgctatgtgaa |
46714718 |
T |
|
| Q |
195 |
tgaattgg-nnnnnnnnnagaggatgtgaatgaattagttgtgtatttatagagagaatagaaa |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46714719 |
tgaattggttttttttttagaggatgtgaatgaattagttgtgtatttatagagagaagagaaa |
46714782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3630 times since January 2019
Visitors: 4816