View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_24 (Length: 338)
Name: NF0749_low_24
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 89 - 264
Target Start/End: Complemental strand, 52076122 - 52075947
Alignment:
| Q |
89 |
ggaggaacatgattccaatcatgagttggtgaaatttcagaaggataaggttagggatcagattgagagtgttgttgtcgttgattatgtggtgccgccg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52076122 |
ggaggaacatgattccaatcatgagttgatgaaatttcagaaggataaggttagggatcagattgagagtgttgttgtcgttgattatgtggtgccgccg |
52076023 |
T |
 |
| Q |
189 |
ccaccacctcctcaatcggcaagtctttgatgaaggttatttctgtttgatcattgcttttgaatttttcacttct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52076022 |
ccaccacctcctcaatcggcaagtctttgatgaaggttatttctgtttgatcattgcttttgaatttttcacttct |
52075947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University