View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0749_low_28 (Length: 310)

Name: NF0749_low_28
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0749_low_28
NF0749_low_28
[»] chr1 (1 HSPs)
chr1 (99-222)||(40084993-40085116)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 99 - 222
Target Start/End: Complemental strand, 40085116 - 40084993
Alignment:
99 tgggttcattaccggggttaaccaatctcattctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacct 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40085116 tgggttcattaccggggttaaccaatctcattctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacct 40085017  T
199 aaagcacaactctctcacaggttc 222  Q
    |||||||||||||||||| |||||    
40085016 aaagcacaactctctcaccggttc 40084993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4872 times since January 2019
Visitors: 4840