View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_32 (Length: 289)
Name: NF0749_low_32
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 54 - 240
Target Start/End: Complemental strand, 22153494 - 22153308
Alignment:
| Q |
54 |
cctgtgagacgaacaagctttcatcttcattagctacattagaagaaacagaagtcgcaaatggcatttttcttcctgcatgctctttctttcgtcggtt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22153494 |
cctgtgagacgaacaagctttcatcttcattagctacattagaagaaacagaagtcgcaaatggcatttttcttcctgcatgctctttctttcgtcggtt |
22153395 |
T |
|
| Q |
154 |
ataatcctgtggaataccatcagaatactcaggctccaaacttggttcatttccagcttcaaggtcttctctaaaactctctctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22153394 |
ataatcctgtggaataccatcagaatactcaggctccaaacttggttcatctccagcttcaacgtcttctctaaaactctctctctg |
22153308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3497 times since January 2019
Visitors: 4814