View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_33 (Length: 283)
Name: NF0749_low_33
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 54 - 205
Target Start/End: Complemental strand, 40758243 - 40758092
Alignment:
| Q |
54 |
agagaattgtagaaatgaagaagagaacgatgagtctctcgccgttgaaaaacgacgtcgtcatggaaaatgttctaaaccagaattgggttttacgcgg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758243 |
agagaattgtagaaatgaagaagagaacgatgagtctctcgccgttgaaaaacgatgtcgtcatggaaaatgttctaaaccagaattgggttttacgcgg |
40758144 |
T |
 |
| Q |
154 |
gaagatgaagctaactatagaaagaagaagaaggttgttggactctcatttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758143 |
gaagatgaagctaactatagaaagaagaagaaggttgttggactctcatttt |
40758092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University