View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_35 (Length: 274)
Name: NF0749_low_35
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 37 - 224
Target Start/End: Original strand, 30090947 - 30091134
Alignment:
| Q |
37 |
gaacacatcggtaccaattctagctgttggtttataaggaacaaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccatgga |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30090947 |
gaacacatcggtaccaattctagctgttggtttataaggaacaaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccaagga |
30091046 |
T |
 |
| Q |
137 |
aagccatgtgatggacctcttgatgagtaatgagctgcaattggtgccggttttattccaagaaatgtttgttgaaacttaatgcttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30091047 |
aagccatgtgatggacctcttgatgagtaatgagctgcaattggtgccggttttattccaagaaatgtttgttgaaacttaatgcttg |
30091134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 37 - 227
Target Start/End: Complemental strand, 30099969 - 30099779
Alignment:
| Q |
37 |
gaacacatcggtaccaattctagctgttggtttataaggaacaaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccatgga |
136 |
Q |
| |
|
|||||||| || |||||||||||||||||||| | ||||| | |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
30099969 |
gaacacatttgtgccaattctagctgttggtttgttaggaatataagctgcaagaactcttgatccaggtgccattatatcaggtttcaaaatccatgga |
30099870 |
T |
 |
| Q |
137 |
aagccatgtgatggacctcttgatgagtaatgagctgcaattggtgccggttttattccaagaaatgtttgttgaaacttaatgcttgatg |
227 |
Q |
| |
|
||| |||||| ||||||||||||||||||| |||||| ||||||||| ||| |||| | ||||||||||||||| || |||||||||| |
|
|
| T |
30099869 |
tagctatgtgaaggacctcttgatgagtaatatgctgcagctggtgccggctttgttcctacaaatgtttgttgaaatttgatgcttgatg |
30099779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University