View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_37 (Length: 264)
Name: NF0749_low_37
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 36756870 - 36756659
Alignment:
| Q |
18 |
ggtagattatacttccaccgtggaaacaagagtttccaaacagctaactggtctaaccgtgtatatctcatcaagataatgatatatcgatgactctatt |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
36756870 |
ggtagattttacttccaccgtggaaacaagagtttccaaacagctaactggtctaaccgtgtatatctcatcaagataatgatttattgatgactctatt |
36756771 |
T |
 |
| Q |
118 |
tactatgcgggtttgagattttacagcatattatggctgaaccttcctcaccaggataccgtagcagagttggttttggagactgaacttcttcatgtgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36756770 |
tactatgcgggtttgagattttacagcgtattatggctgaaccttcttcaccaggataccgtagcagagttggttttggagactgaacttcttcatgtgc |
36756671 |
T |
 |
| Q |
218 |
ttgaagtagtag |
229 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
36756670 |
ttgaagaagtag |
36756659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University