View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_40 (Length: 251)
Name: NF0749_low_40
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_40 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 648372 - 648594
Alignment:
| Q |
29 |
atctatgccatatcaccatcagttatgacatgaagttgcaaggatggagcaatgtggtaaaatgatgaaggaaataatattattaggtgtaacattctat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
648372 |
atctatgccatatcaccatcagttatgacatgaagttgcaaggatggagcaatgtggtaaaattatgaaggaaataatattattaggtgtaacattctat |
648471 |
T |
|
| Q |
129 |
agcaggaattgaataatattctgtaccaggcatggaataacattattggtaaaaatatcgcagtttatcattctcaggaatgtaattttattgctggata |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
648472 |
agcaggaattgaataatattctgtaccaggcatggaataacattattggtaaaaatatcgcagtttatcattctcaggaatgtaattttattgctggata |
648571 |
T |
|
| Q |
229 |
taaacaacatttggttaatgaat |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
648572 |
taaacaacatttggttaatgaat |
648594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5544 times since January 2019
Visitors: 4857