View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_43 (Length: 242)
Name: NF0749_low_43
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0749_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 100
Target Start/End: Complemental strand, 36998246 - 36998150
Alignment:
| Q |
4 |
tatttttaattaaatagaacaatgnnnnnnnaaggaattaaatagaactaatggtttcgacatagccttcttccaaagaaacattcaaaactgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
36998246 |
tatttttaattaaatagaacaatgtttttttaaggaattaaatagaactaatggtttcgacatagccttcttccaaagaaacgttaaaaactgatga |
36998150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5243 times since January 2019
Visitors: 4847