View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0749_low_48 (Length: 213)
Name: NF0749_low_48
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0749_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 8086023 - 8086226
Alignment:
Q |
1 |
accttcgtcatccatcactttgaccaccattgacaacaattccaacccccactgatta-tattatgcccaaaactctagccgcctctcacccccacttaa |
99 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
8086023 |
accttcgtcatccatcactttgatcaccattgacaacaattccaaccaccactgattactattatgaccaaaactctagccgcctctcacccccacttaa |
8086122 |
T |
 |
Q |
100 |
tttgatctccattggctaccactcagttggctaccatcaaccaccactgatcgccactctaacaatcgccggtgattaacaatttagcaaaaccatgagt |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
8086123 |
tttgatctccattggctaccactcagttggctaccaccaaccaccactgatcgccactctagcaatcgccggtgattaacaatttagcaaaaccatgagt |
8086222 |
T |
 |
Q |
200 |
atta |
203 |
Q |
|
|
|||| |
|
|
T |
8086223 |
atta |
8086226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University