View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0749_low_49 (Length: 213)

Name: NF0749_low_49
Description: NF0749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0749_low_49
NF0749_low_49
[»] chr4 (1 HSPs)
chr4 (43-138)||(36900001-36900096)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 36900001 - 36900096
Alignment:
43 gtcaccaatcgaggaagtccggttaacggtgnnnnnnnccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtctcctctc 138  Q
    |||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
36900001 gtcaccaatcgaggaagtccggttaacggtgaaaaaaaccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctc 36900096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5624 times since January 2019
Visitors: 4857