View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_high_36 (Length: 324)
Name: NF0750_high_36
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 30 - 264
Target Start/End: Original strand, 43987144 - 43987382
Alignment:
| Q |
30 |
aggatgaggaggacatgagcgtgtgttgttgctgactgtggaatatagtggacacgtgttaagatatttggttgactaggatttagaggaagtgagtagg |
129 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43987144 |
aggaagagaaggacatgagcgtgtgttgttgctgactgtggaatatagtggacacgtgttaagatatttggttgactaggatttagaggaaatgagtagg |
43987243 |
T |
 |
| Q |
130 |
aactggggaagattcgttatggacacgtggagaattacggttgctgtaactaaatttatttatctgtttttgtggatttgtaaatgtaattggg----gg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43987244 |
aactggggaagattcgttatggacacgtggaggattacggttgctgtaactaaatttatttatctgtttttgtggatttgtaaatgtaattgggggaagg |
43987343 |
T |
 |
| Q |
226 |
aaggaaggaggagtgaggaaaagatttgaaatgatgatg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43987344 |
aaggaaggaggagtgaggaaaagatttgaaatgatgatg |
43987382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University