View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_high_44 (Length: 288)
Name: NF0750_high_44
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 12899415 - 12899552
Alignment:
| Q |
1 |
tgcctaagatggattacctaacaccagataggattagttgagcaccacatgacattgaattcacgacatcaccattttaattacacaccttataacagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12899415 |
tgcctaagatggattacctaacaccagataggattagttgagcaccacatgacattgaattcacgacatcacca-tttaattacacaccttataacagaa |
12899513 |
T |
 |
| Q |
101 |
aatgtgaacatcaatcactatttaatccatctcatcacg |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12899514 |
aatgtgaacatcaatcactatttaatccatctcatcacg |
12899552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University