View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_high_53 (Length: 254)

Name: NF0750_high_53
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_high_53
NF0750_high_53
[»] chr2 (1 HSPs)
chr2 (1-116)||(43799907-43800022)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 43800022 - 43799907
Alignment:
1 ctattacagctgtggttaattagatacactactataatagttgaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataac 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43800022 ctattacagctgtggttaattagatacactactataatagtttaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataac 43799923  T
101 ttttgttacattatgg 116  Q
    ||||||||||||||||    
43799922 ttttgttacattatgg 43799907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5656 times since January 2019
Visitors: 4858