View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_high_56 (Length: 250)
Name: NF0750_high_56
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 10 - 155
Target Start/End: Original strand, 12899078 - 12899218
Alignment:
| Q |
10 |
aacaatattatcgttgattataaagttatattatgtaattaaccttgcataactcataatttttcttatccatacaatattaattaaattcttatttttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12899078 |
aacaatattatcgttgattataaagttatattat-----taaccttgcataactcataatttttcttatctatacaatattaattaaattcttatttttg |
12899172 |
T |
|
| Q |
110 |
taaaatcgtcaaaaataacttgtaattttagacaaaataaatattg |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12899173 |
taaaatcgtcaaaaacgacttgtaattttagacaaaataaatattg |
12899218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5843 times since January 2019
Visitors: 4860