View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_high_60 (Length: 245)
Name: NF0750_high_60
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_high_60 |
 |  |
|
[»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 143 - 245
Target Start/End: Original strand, 797800 - 797901
Alignment:
Q |
143 |
ctttgaattcttcttctctcaagcttaacattgttgttgctcagatttttctctgttcaaaatgatgaaaatcgatgtctcgtttttcaaatactgtgtt |
242 |
Q |
|
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
797800 |
ctttgaattcctcttctctcaagctta-cattgttgttgctcagatttttctctgttcaaaatgatgaaaatcgatgtctcgtttttcaaatactgtgtt |
797898 |
T |
 |
Q |
243 |
cgt |
245 |
Q |
|
|
||| |
|
|
T |
797899 |
cgt |
797901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 112
Target Start/End: Original strand, 797675 - 797765
Alignment:
Q |
22 |
tttcgtgcattcaattactcatttccattttcacgttccagttctcagcttcctccattttcctctgcaatttcatcactgtaagtcaaaa |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
797675 |
tttcgtgcattcaattactcatttccattttcacgttccttttctcagcttcctccattttcctctgcaatttcatcactgtaagtcaaaa |
797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 242
Target Start/End: Original strand, 798004 - 798059
Alignment:
Q |
186 |
gatttttctctgttcaaaatgatgaaaatcgatgtctcgtttttcaaatactgtgtt |
242 |
Q |
|
|
|||||||| ||||| |||||||||||||| ||||| || |||||||||||| ||||| |
|
|
T |
798004 |
gatttttcactgttgaaaatgatgaaaatagatgt-tcatttttcaaatacagtgtt |
798059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5629 times since January 2019
Visitors: 4857