View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_high_64 (Length: 239)

Name: NF0750_high_64
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_high_64
NF0750_high_64
[»] chr8 (1 HSPs)
chr8 (23-86)||(37436111-37436174)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 23 - 86
Target Start/End: Original strand, 37436111 - 37436174
Alignment:
23 tcttcattatttcctccttaactacaggtcagcaccatcttctctttccttcaactcttcatct 86  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37436111 tcttcattatttcctccttaactacaggtcagcaccatcttctctttccttcaactcttcatct 37436174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University