View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_11 (Length: 521)
Name: NF0750_low_11
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 78 - 490
Target Start/End: Complemental strand, 52183586 - 52183174
Alignment:
| Q |
78 |
agcataactgtacgcagagggacacgcagacttgaacatctctgagtactgtgttggactgcaactctgtggactcgaatgttcaccggtgcaacaaaat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52183586 |
agcataactgtacgcagagggacacgcagacttgaacatctctgagtactgtgttgaactgcaactctgtggactcgaatgttcaccggtacaacaaaat |
52183487 |
T |
|
| Q |
178 |
tcctcggttttaaacgctgcacacgcactcttacaggccaccaccgaaccccctacctctgttacctgcaactccgctggacaatgacttttcaaatctg |
277 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
52183486 |
tcctcggtattaaacgctgcacacgcactcttacaggccaccaccgaaccccctacctctgttacctgcaactccgctggacaatgactgttcaaatccg |
52183387 |
T |
|
| Q |
278 |
caacacaacctgcatactgacaatcacctgttcctctggttgcttgtatccctatcccgacattgtaaccatccaccaaactaacgtcatagaagtcttt |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183386 |
caacacaacctgcatactgacaatcacctgttcctctggttgcttgtatccctatcccgacattgtaaccatccaccaaactaacgtcatagaagtcttt |
52183287 |
T |
|
| Q |
378 |
atctccactcacgcttccgatcgtaaattccgccaacgtcactggaggagcacctccaccattgcatttcaatcctccagtgcagtctccggtgatgcaa |
477 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52183286 |
atctccactcacgcttccgatcgtaaattccgccaacgtcactggaggagcacctccaccattgcatttcaatcctccggtgcagtctccggtgatgcaa |
52183187 |
T |
|
| Q |
478 |
ttcccgttaccag |
490 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52183186 |
ttcccgttaccag |
52183174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 6679231 - 6679167
Alignment:
| Q |
163 |
ccggtgcaacaaaattcctcggttttaaacgctgcacacgcactcttacaggccaccaccgaacc |
227 |
Q |
| |
|
|||||||||||||||||||| | || ||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
6679231 |
ccggtgcaacaaaattcctccatattgaacgccaaacacgcgctcttacaagccaccaccgaacc |
6679167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5316 times since January 2019
Visitors: 4847