View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_110 (Length: 208)
Name: NF0750_low_110
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_110 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 1704160 - 1704056
Alignment:
| Q |
1 |
cttttccagggatttgtatcacttggggattgattgtaacagtcatgtgttactcagttggtcatatctctggaggcctcttcaaccctgctgttaccat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1704160 |
cttttccagggatttgcatcacttgggggttgattgtaacagtcatgtgttactcagttggtcatatctctggaggcctcttcaaccctgctgttaccat |
1704061 |
T |
 |
| Q |
101 |
cacct |
105 |
Q |
| |
|
||||| |
|
|
| T |
1704060 |
cacct |
1704056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 3 - 103
Target Start/End: Original strand, 34019127 - 34019227
Alignment:
| Q |
3 |
tttccagggatttgtatcacttggggattgattgtaacagtcatgtgttactcagttggtcatatctctggaggcctcttcaaccctgctgttaccatca |
102 |
Q |
| |
|
||||||||| | |||||||||||||| | ||||||| ||||||| |||||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
34019127 |
tttccaggggtatgtatcacttgggggcttattgtaatggtcatgtcttactctgttggtcatatctctggaggacatttcaaccctgctgttaccatca |
34019226 |
T |
 |
| Q |
103 |
c |
103 |
Q |
| |
|
| |
|
|
| T |
34019227 |
c |
34019227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University