View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_110 (Length: 208)

Name: NF0750_low_110
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_110
NF0750_low_110
[»] chr3 (1 HSPs)
chr3 (1-105)||(1704056-1704160)
[»] chr5 (1 HSPs)
chr5 (3-103)||(34019127-34019227)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 1704160 - 1704056
Alignment:
1 cttttccagggatttgtatcacttggggattgattgtaacagtcatgtgttactcagttggtcatatctctggaggcctcttcaaccctgctgttaccat 100  Q
    |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1704160 cttttccagggatttgcatcacttgggggttgattgtaacagtcatgtgttactcagttggtcatatctctggaggcctcttcaaccctgctgttaccat 1704061  T
101 cacct 105  Q
    |||||    
1704060 cacct 1704056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 3 - 103
Target Start/End: Original strand, 34019127 - 34019227
Alignment:
3 tttccagggatttgtatcacttggggattgattgtaacagtcatgtgttactcagttggtcatatctctggaggcctcttcaaccctgctgttaccatca 102  Q
    ||||||||| | ||||||||||||||  | |||||||  ||||||| |||||| |||||||||||||||||||| |  ||||||||||||||||||||||    
34019127 tttccaggggtatgtatcacttgggggcttattgtaatggtcatgtcttactctgttggtcatatctctggaggacatttcaaccctgctgttaccatca 34019226  T
103 c 103  Q
    |    
34019227 c 34019227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University