View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_111 (Length: 204)
Name: NF0750_low_111
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_111 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 26 - 201
Target Start/End: Original strand, 1638837 - 1639012
Alignment:
| Q |
26 |
agtattaaataaagttaaatgatcaatgttgcacagtattgccttgtttcttttgtgagttcagtctaacattttttcatttcgtttacgcctattttta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1638837 |
agtattaaataaagttaaatgatcaatgttgcacagtattgccttgtttcttttgtgagttcagtctaacattttttcatttcgtttacgcctattttta |
1638936 |
T |
|
| Q |
126 |
tatatttgggagggaagagaaaacccttacaaattacagctcttttgcaagcaagaatgggttccgcatgttcaat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1638937 |
tatatttgggagggaagagaaaacccttacaaattaccgctcttttgcaagcaagaatgggttccgcatgttcaat |
1639012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4830 times since January 2019
Visitors: 4840