View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_42 (Length: 350)
Name: NF0750_low_42
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 39239681 - 39239429
Alignment:
| Q |
13 |
aatatgacaatgggagaaagagtgatctagtcgatgaaggagattatgacgaagaatttcatcatggggttgaattatgtgaagaaatgggttttagaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39239681 |
aatatgacaatgggagaaagagtgatctagtcgatgaaggagattatgacgaagaatttcatcatggggttgaattatgtgaagaaatgggttttagaga |
39239582 |
T |
 |
| Q |
113 |
agaagtgcaagaaggtgaaggaatagataaacgtgctgatgagttcattgctaaattccgtcagcaaatgagactgcagcgccagatgtctcttctacaa |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39239581 |
agaagttcaagaaggtgaaggaatagataaacgtgctgatgagttcattgctaaattccgtcagcaaatgagactgcagcgccagatttctcttctacaa |
39239482 |
T |
 |
| Q |
213 |
tacaaggaaacacccagcagagacacaaactgatcgacaccttatacatgcaa |
265 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39239481 |
tacaagaaaacacccagcagagacacaaactgatcgacaccttatacatgcaa |
39239429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University