View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_44 (Length: 344)
Name: NF0750_low_44
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 29 - 335
Target Start/End: Original strand, 26610878 - 26611191
Alignment:
| Q |
29 |
atgtcttgcatgtatttatggacatgtctgtttactattgtttgcatggtattttgctactgagttttgtactatgtacttatatttatggacatgtcta |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26610878 |
atgtcttgcatgtatttatggacatgtctgtttactattgtttgcatggtattttgctactaagctttgtactatgtacttatatttatggacatgtcta |
26610977 |
T |
 |
| Q |
129 |
tcacttatttatcttgaatatcannnnnnncacgttgcag----gttcacacttcacaacaaataaatatacggcaacaattaataaaaactatacaatc |
224 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26610978 |
tcacttatttatcttgaatatcatttttttcacgttgcagacaggttcacacttcacaacaaataaatatacgacaacaattaataaaaactatacaatc |
26611077 |
T |
 |
| Q |
225 |
tgaaataact--taataaacgacaacaataaccaatctttatcttattaggtg-ggatgctacatgaatcaaattacgttatagtgttttataaaaaatc |
321 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26611078 |
tgaaataacttataataaacgacaacaataatcaatctttatcttattaggtgaggatgctacatgaatcaaattacgttatagtgttttataaaaaatc |
26611177 |
T |
 |
| Q |
322 |
gtattgatattgtt |
335 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26611178 |
gtattgatattgtt |
26611191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University