View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_46 (Length: 338)
Name: NF0750_low_46
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 31 - 132
Target Start/End: Complemental strand, 797900 - 797800
Alignment:
| Q |
31 |
cgaacacagtatttgaaaaacgagacatcgattttcatcattttgaacagagaaaaatctgagcaacaacaatgttaagcttgagagaagaagaattcaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
797900 |
cgaacacagtatttgaaaaacgagacatcgattttcatcattttgaacagagaaaaatctgagcaacaacaatg-taagcttgagagaagaggaattcaa |
797802 |
T |
 |
| Q |
131 |
ag |
132 |
Q |
| |
|
|| |
|
|
| T |
797801 |
ag |
797800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 163 - 253
Target Start/End: Complemental strand, 797765 - 797675
Alignment:
| Q |
163 |
ttttgacttacagtgatgaaattgcagaggaaaatggaggaagctgagaactggaacgtgaaaatggaaatgagcaattgaatgcacgaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
797765 |
ttttgacttacagtgatgaaattgcagaggaaaatggaggaagctgagaaaaggaacgtgaaaatggaaatgagtaattgaatgcacgaaa |
797675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 89
Target Start/End: Complemental strand, 798059 - 798004
Alignment:
| Q |
33 |
aacacagtatttgaaaaacgagacatcgattttcatcattttgaacagagaaaaatc |
89 |
Q |
| |
|
||||| |||||||||||| || ||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
798059 |
aacactgtatttgaaaaatga-acatctattttcatcattttcaacagtgaaaaatc |
798004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University