View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_48 (Length: 328)
Name: NF0750_low_48
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 15 - 162
Target Start/End: Original strand, 33112377 - 33112524
Alignment:
| Q |
15 |
ttacgtataagtataaccaagtccaccatgcatatgtttgaaaatatgatatgatttgtgtaaaaacttagaagtctattgaaccacacccaattttgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112377 |
ttacgtataagtataaccaagtccaccatgcatatgtttgaaaatatgatatgatttgtgtaaaaacttagaagtctattgaaccacacccaattttgtg |
33112476 |
T |
|
| Q |
115 |
aatcttgttaaaccattttataaaagtagatttatatggttatctgtg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33112477 |
aatcttgttaaaccattttataaaagtagatttatatggttatgtgtg |
33112524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4833 times since January 2019
Visitors: 4840