View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_49 (Length: 327)
Name: NF0750_low_49
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 67 - 241
Target Start/End: Complemental strand, 37219203 - 37219029
Alignment:
Q |
67 |
ttctccaacattaacaaacacgtaagtagattcaataccatttgtcaaaagatattaaaatttaattatgtcaaatttatgacttgagtttcatctgtca |
166 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37219203 |
ttctccaacattaacaaacacgtaagtagattcaataccatttgtcaaaagaaattaaaatttaattatgtcaaatttatgacttgagtttcatctgtca |
37219104 |
T |
 |
Q |
167 |
aatttcagggatgaaactccttttatgaccaatgccacagaatcatatcagccacaatttcaagggtgcaactcc |
241 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37219103 |
aatttcagggatgaaactccttttatgaccaatgccacagaatcatatcagccacaatttcaagggtgcaactcc |
37219029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University