View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_51 (Length: 322)
Name: NF0750_low_51
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 29 - 308
Target Start/End: Complemental strand, 35722284 - 35722005
Alignment:
Q |
29 |
aagtaggaggtgttattctcacttattatcattgtagtgcatggcccataaggttgccttgtgagggtgatcacaccgacaactatagcaacgagcnnnn |
128 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35722284 |
aagtaggaggtgtgattctcacttattatcattgtagtgcatggcccataaggttgccttgtgagggtgatcacaccgacaactatagcaacgagcaaaa |
35722185 |
T |
 |
Q |
129 |
nnnggatctgaaatcaaattattccattgtttggagacacttttgaacctaaatagagactttataggaagatacacaagaatttcccttatgacaagtt |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35722184 |
aaaggatctgaaatcaaattattccattgtttggagacacttttgaacctaaatagagactttataggaagatacacaagaatttcccttatgacaagtt |
35722085 |
T |
 |
Q |
229 |
cgggcaagtcaccattgttcggcatcacttgcttgttattgacttcatatgccatttgagaaccctcttgagtgtctatt |
308 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35722084 |
cgggcaagtcaccattgttcggcatcacttgcttgttattgacttcatatgccatttgagaaccctcttgagtgtctatt |
35722005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5110 times since January 2019
Visitors: 4845