View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_52 (Length: 322)
Name: NF0750_low_52
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 80 - 297
Target Start/End: Complemental strand, 41173277 - 41173060
Alignment:
| Q |
80 |
agcataggcaacttaaaattctggatcgtagctctatcattgccaatctagtaaatgcaatgtctaggggaaaagtggtagaagaatacaaaatgatttg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41173277 |
agcataggcaacttaaaattctggatcgtagctctatcattgccaatctagtaaatgcaacgtctaggggaaaagtggtagaagaatacaaaatgatttg |
41173178 |
T |
|
| Q |
180 |
cctcacatagagtcatgccaaattgcttgatgacttatactataactannnnnnnnactgcactattaattcaatttaattccattagtcacttttatgg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41173177 |
cctcacatagagtcatgccaaattgcttgatgatttatactataactattttttttactgcactattaactcaatttaattccattagtcacttttatgg |
41173078 |
T |
|
| Q |
280 |
atttatataaagcacagg |
297 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41173077 |
atttatataaagcacagg |
41173060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5232 times since January 2019
Visitors: 4847