View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_54 (Length: 316)
Name: NF0750_low_54
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 97 - 208
Target Start/End: Complemental strand, 27425093 - 27424982
Alignment:
| Q |
97 |
atcaccgagatataaaatgtttacctgagggtacactgatgctagatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaatccgagat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425093 |
atcaccgagatataaaatgtttacctgagggtacactgatgctagatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaatccgagat |
27424994 |
T |
|
| Q |
197 |
tttgaatatttc |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27424993 |
tttgaatatttc |
27424982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 98 - 201
Target Start/End: Complemental strand, 27404064 - 27403961
Alignment:
| Q |
98 |
tcaccgagatataaaatgtttacctgagggtacactgatgctagatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaatccgagatt |
197 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27404064 |
tcactgagttatgaaatgtttacctgagggtacacagatgctagatatgatgcttcccttgagaatggataggatgcatgtaaaagaacgatccgagatt |
27403965 |
T |
|
| Q |
198 |
ttga |
201 |
Q |
| |
|
|||| |
|
|
| T |
27403964 |
ttga |
27403961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 140 - 189
Target Start/End: Complemental strand, 27449950 - 27449901
Alignment:
| Q |
140 |
agatatgatgcttcctttgagaatggataggatgcatgtaaaagaacaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
27449950 |
agatatgatgcttcctttgagaatggatatgatgtatgtaaaagaacaat |
27449901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4848 times since January 2019
Visitors: 4840