View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_56 (Length: 308)
Name: NF0750_low_56
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 46 - 297
Target Start/End: Complemental strand, 7924644 - 7924382
Alignment:
| Q |
46 |
aggacatgcatctggaaaaacctcatacatcccaactaagttggcatctctagagaaccctcgtcctcttctgtcaacctcactatt----catatcaag |
141 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7924644 |
aggacatgcatctggaaaaaccttatacatcccaactaagttggcatatctgaagaacccctgtcctcttctgtcaacctcactattaattcatatcaag |
7924545 |
T |
 |
| Q |
142 |
agtaatctta-------caaaacgaaataaaatacgtttagcacttacctagtctgatttccgtcaaagacagatgtttctcgcctctactccttcgtac |
234 |
Q |
| |
|
|| ||||||| || |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924544 |
aggaatcttaaacgttacataacgaaataaaacacgattagcacttacctagtctgatttccgtcaaagacagatgtttctcgcctctactccttcgtac |
7924445 |
T |
 |
| Q |
235 |
gatatatcattactcttattttgaatgataaatgcaattctcaattcttcaatttctgtctct |
297 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924444 |
gatatcgcattactcttattttgaatgataaatgcaattctcaattcttcaatttctgtctct |
7924382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University