View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_62 (Length: 294)
Name: NF0750_low_62
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 43800095 - 43800159
Alignment:
Q |
1 |
aaaggaaaaacaactgcaataataccaaggttgcaacttgaaccgaacgaaattaaacctaaaat |
65 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
43800095 |
aaaggaaaaacaactgcaataataccaaggttgcaacttgaaccgaacgaaattaaacttaaaat |
43800159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5242 times since January 2019
Visitors: 4847