View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_62 (Length: 294)

Name: NF0750_low_62
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_62
NF0750_low_62
[»] chr2 (1 HSPs)
chr2 (1-65)||(43800095-43800159)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 43800095 - 43800159
Alignment:
1 aaaggaaaaacaactgcaataataccaaggttgcaacttgaaccgaacgaaattaaacctaaaat 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
43800095 aaaggaaaaacaactgcaataataccaaggttgcaacttgaaccgaacgaaattaaacttaaaat 43800159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University