View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_66 (Length: 288)

Name: NF0750_low_66
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_66
NF0750_low_66
[»] chr2 (1 HSPs)
chr2 (1-139)||(12899415-12899552)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 12899415 - 12899552
Alignment:
1 tgcctaagatggattacctaacaccagataggattagttgagcaccacatgacattgaattcacgacatcaccattttaattacacaccttataacagaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
12899415 tgcctaagatggattacctaacaccagataggattagttgagcaccacatgacattgaattcacgacatcacca-tttaattacacaccttataacagaa 12899513  T
101 aatgtgaacatcaatcactatttaatccatctcatcacg 139  Q
    |||||||||||||||||||||||||||||||||||||||    
12899514 aatgtgaacatcaatcactatttaatccatctcatcacg 12899552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5601 times since January 2019
Visitors: 4857