View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_71 (Length: 270)
Name: NF0750_low_71
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 30 - 249
Target Start/End: Original strand, 3675141 - 3675356
Alignment:
Q |
30 |
catgtaaacatgtcttgtcctgcaagttatgggtcgaatctaatcctaactcnnnnnnnnnnngtggtaaaagggtgtctaaggacaattagtccggtgg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||| |
|
|
T |
3675141 |
catgtaaacatgtcttgtcctgcaagttatgggtcgaatctaatccaaactaaaaaaaata---tagtaaaagggtgtctaaggacaattagtccggtgg |
3675237 |
T |
 |
Q |
130 |
aagaagagattgtagggtttagattgacattcaaattacccattctgactatcaagtcttgcctcaaggctcaaagaggtatttacatatcattttacta |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| || |
|
|
T |
3675238 |
aagaagagattgtagggtttagattgacattcaaattatccattctgactatcaagtcgtgcctcaaggctcaaagaggtatttacatatca-tttatta |
3675336 |
T |
 |
Q |
230 |
attaaaaaggtcatcatatt |
249 |
Q |
|
|
|||||||| ||||||||||| |
|
|
T |
3675337 |
attaaaaaagtcatcatatt |
3675356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University