View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_73 (Length: 261)
Name: NF0750_low_73
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 56133412 - 56133469
Alignment:
| Q |
119 |
aaggacaccaatgggtggtttccttggatccctatcttctctttctgctacacaccta |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56133412 |
aaggacaccaatgggtggtttccttggatccctatcttctctttctgctacacaccta |
56133469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 56133299 - 56133350
Alignment:
| Q |
1 |
tcatagtagttgttattatataatttgacagatggaaacaacaaaattcata |
52 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
56133299 |
tcatagtagttgttatcatataatttgacagatggaaacaacaaaattcata |
56133350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3507 times since January 2019
Visitors: 4814