View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_73 (Length: 261)

Name: NF0750_low_73
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_73
NF0750_low_73
[»] chr4 (2 HSPs)
chr4 (119-176)||(56133412-56133469)
chr4 (1-52)||(56133299-56133350)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 56133412 - 56133469
Alignment:
119 aaggacaccaatgggtggtttccttggatccctatcttctctttctgctacacaccta 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56133412 aaggacaccaatgggtggtttccttggatccctatcttctctttctgctacacaccta 56133469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 56133299 - 56133350
Alignment:
1 tcatagtagttgttattatataatttgacagatggaaacaacaaaattcata 52  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||    
56133299 tcatagtagttgttatcatataatttgacagatggaaacaacaaaattcata 56133350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3507 times since January 2019
Visitors: 4814